Skip to content

Latest commit

 

History

History
37 lines (23 loc) · 1.23 KB

File metadata and controls

37 lines (23 loc) · 1.23 KB

Split Fasta

Split Fasta is a command-line tool which allows you to split the Fasta file with multiple sequences into individual Fasta files.

Installation

You can install Split Fasta from PyPI: pip install split-fasta

The Split Fasta works with Python 3.6 & above.

How to use?

The Split Fasta is a command-line tool, named splitfasta. To start it you have to go to the folder containing the Fasta file and then use the following syntax:- splitfasta filename.fasta

And it will split the combined Fasta file into individual files and save it into filename_split_files directory with names from filename_1 to filename_n.

It accepts only .fasta and .fa files where each sequence is separated by '>'

The example input file is :-

>ID-1
ATGGCTCGAGCACCCGAGGAAGTCGAAGGCGGAGCCCAAGAAGAAGCTCCACCCCTCGCACGAGGCGGTGTTCGAACGCT
>ID-2
ATGGCTCGAGCACCCGAGGAAGTCGAAGGCGGAGCCCAAGAAGAAGCTCCACCCCTCGCACGAGGCGGTGTTCGAACGCT

Detailed Tutorial

You can check out the detailed tutorial here

License

© 2020 Udit Vashisht

This repository is licensed under the MIT license. See LICENSE for details.