Skip to content

erlanders177/bioforge

Repository files navigation

BioForge — High-Performance Bioinformatics Engine

Tests Python License

A bioinformatics engine built for Edge Computing.
No Biopython. No heavy dependencies. NumPy core + optional C engine for maximum speed.


Why this exists

Most bioinformatics tools are built for servers with gigabytes of RAM.
BioForge was built for the opposite: low-power hardware, minimal footprint, maximum speed — running genetic analysis offline and locally.

Two core rules:

  • Zero Python loops in the hot path — every operation is vectorised with NumPy.
  • 5-bit encoding — every biological symbol fits in 5 bits, saving 37.5% memory vs ASCII.

What's in the box

BioForge is one lightweight engine bundling several tools — a single pip install, a single dependency (NumPy), a shared C backend. Each tool has its own section (with examples) further down.

Category Tools
Storage & I/O 5-bit sequence storage · streaming FASTA/FASTQ parser (C) · .gz / BGZF
Sequence transforms DNA→protein translation · reverse complement · 6-frame translation
Alignment pairwise (Needleman–Wunsch / banded / Smith–Waterman) · multiple sequence alignment (center-star)
Genome mapping long-read seed-chain-align mapper, whole pipeline in C, PAF output — on par with minimap2 on multi-core, ~99.8% accurate
Analysis & QC FastQC-style quality report · GC content · k-mer spectrum
Evolution (v7.0) mutation ranking · stable lineage designation (Pango/autolin-style, no tree) · honest backtesting — bioforge-evolution

Why one engine instead of a pile of separate tools? Fewer resources and less friction — no piping data between programs, no format conversions, one install that runs on low-power/edge hardware. Competitive at each task, and unique in combining them (especially the evolution front).


Key numbers

Operation Result
Memory (30M bases) 18.75 MB (37.5% less than plain ASCII)
Translation throughput ~5 M amino acids / second (NumPy) · ~27× faster with C engine
NW alignment 1000×1000 nt ~165 ms (NumPy) · ~29× faster with C engine
Genome mapping — speed vs minimap2 on par on multi-core, ~1.18× behind single-thread (E. coli scale, minimap2 -a; tools/bench_vs_minimap2.py)
Genome mapping — accuracy vs minimap2 ~99.8% of reads mapped to the correct position on real E. coli, matching minimap2 (tools/accuracy_vs_minimap2.py)
FASTA ingestion (C batch parser) ~80 M bases / second
FASTQ ingestion (C batch parser) ~14 M bases / s · ~94 K reads / s
QC filter 200 K reads (columnar) 0.28 s18.6× faster than per-record
vs Biopython — QC filter ~5–6× faster, identical result
vs Biopython — load all in RAM ~6.9× less memory (115 MB vs 801 MB) · ~9.5× faster
Compressed input .gz read transparently in C (zlib, static-linked)
Evolution — mutation ranking cross-virus AUC ~0.77–0.95 on flu HA, beats a linear model on all 6 held-out tests (trained model runs in pure NumPy)
Dependencies NumPy (C engine + trained ranker included, pre-compiled)

Architecture

┌──────────────────────────────────────────────────────────────┐
│  Level 4 — genomemap · minimizers · refindex   Genome mapper  │
│  seed-chain-align (minimap2-style) · whole pipeline in C      │
├──────────────────────────────────────────────────────────────┤
│  Level 3 — bioforge/aligner.py           NW alignment         │
│  Anti-diagonal wavefront O(m+n) · mutation detection         │
├──────────────────────────────────────────────────────────────┤
│  Level 2 — bioforge/smart_translator.py  DNA → Protein       │
│  CODON_LUT + sliding_window_view · first-ATG ORF detection   │
├──────────────────────────────────────────────────────────────┤
│  Level 1 — bioforge/biocore.py           5-bit storage        │
│  BitPacker · PackedSequence · SmartImporter · LUTs           │
├──────────────────────────────────────────────────────────────┤
│  C engine — bioforge/engine/engine.c     Optional backend     │
│  GCC -O3 -fopenmp · auto-loaded via ctypes · NumPy fallback  │
└──────────────────────────────────────────────────────────────┘

The 5-bit unified alphabet

Every biological symbol — nucleotides, amino acids, gaps, stop codons and ambiguous bases — fits in a single 5-bit scheme (32 states).
One encoding covers DNA, RNA, and proteins in the same pipeline.

State  Symbol            State  Symbol
  0    Adenine   (A)      14    Methionine    (M)
  1    Cytosine  (C)      ...   (all 20 amino acids: 4–23)
  2    Guanine   (G)      24    STOP codon    (*)
  3    Thymine / Uracil   25    Alignment gap (-)
 4–23  Amino acids        31    Unknown / ambiguous

Installation

pip install bioforge

Native wheels ship for Windows, Linux and macOS with the C engine pre-compiled inside — no compiler needed. On any other platform BioForge falls back to the pure-NumPy path automatically.

From source (latest main):

git clone https://github.com/erlanders177/bioforge.git
cd bioforge
pip install -e .          # only needs NumPy

Requirements

  • Python ≥ 3.10
  • NumPy ≥ 1.24 — the only runtime dependency
  • The C engine ships pre-compiled (OpenMP, zlib and libdeflate statically linked inside the binary). If it can't load on your platform, BioForge falls back to NumPy automatically.

Optional — recompile the C engine (needed only if you build from source on an unsupported platform, or change engine.c):

python bioforge/engine/build.py

Requires GCC. On Windows: MinGW-w64 / MSYS2. On Linux/Mac: sudo apt install gcc / brew install gcc.
If not compiled, BioForge falls back to NumPy automatically — no code changes needed.

For development and testing:

pip install hypothesis pytest pytest-benchmark

Quick start

Import and encode a FASTA sequence

from bioforge import SmartImporter, SeqType

records = SmartImporter.from_string(""">gene_1
ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCC
""")

seq = records[0]
print(seq.n_symbols)      # 33
print(len(seq.data))      # 21  (37.5% smaller than ASCII)
print(seq.to_string())    # ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCC

Stream a huge FASTA/FASTQ with constant RAM

from bioforge import SmartImporter

# One PackedSequence at a time — never loads the whole file
for seq in SmartImporter.stream("genome.fa"):
    print(seq.header, seq.n_symbols)

# FASTQ yields FastqRecord (sequence + Phred qualities)
for rec in SmartImporter.stream_fastq("reads.fastq"):
    if rec.passes_quality(20):
        process(rec.sequence)

Quality-filter millions of reads — the fast lane (columnar)

from bioforge import SmartImporter

total = passed = 0
for batch in SmartImporter.stream_fastq_batches("reads.fastq"):
    mask = batch.passes(20)          # ONE NumPy op for thousands of reads
    total  += len(batch)
    passed += int(mask.sum())
    kept = batch.filter(mask)        # new ReadBatch, no per-read objects
print(f"{passed}/{total} reads with mean quality >= 20")

stream_fastq_batches keeps a whole batch as contiguous matrices instead of one object per read, so filtering 200 000 reads drops from ~5.3 s to ~0.28 s. Materialise a single read only when you need it: batch[i]FastqRecord.

Compressed .gz files are read transparently (decompressed in C):

for rec in SmartImporter.stream_fastq("reads.fastq.gz"):   # no manual gunzip
    ...

Pass n_threads to go multi-core (an adaptive dispatcher picks the best path):

# plain → parallel parse · .gz → libdeflate (~2× faster) + parse
for batch in SmartImporter.stream_fastq_batches("reads.fastq.gz", n_threads=0):
    ...   # n_threads: 1 = sequential (constant RAM) · >1 = threads · 0 = all cores

Reading compressed FASTQ is ~1.6× faster this way (libdeflate beats zlib); plain-file parse parallelism is memory-bandwidth bound, so its gain is modest on few cores but scales on many-core servers.

BGZF — parallel-decompressible .gz (~2× faster reads)

A BGZF file is a valid .gz (any gunzip reads it) but split into independent 64 KB blocks, so BioForge decompresses it across all cores. Convert once a file you'll process repeatedly:

python -m bioforge.bgzf reads.fastq        # or: bioforge-bgzip reads.fastq
# → reads.fastq.gz (BGZF). Reads at ~113 M bases/s vs ~58 for plain .gz.

BioForge auto-detects BGZF and routes to the parallel path; plain .gz keeps using single-thread libdeflate.

GC content and k-mer spectrum — vectorised over a whole batch

from bioforge import SmartImporter

spectrum = None
for batch in SmartImporter.stream_fastq_batches("reads.fastq"):
    gc = batch.gc_content()              # GC fraction per read (NumPy array)
    s  = batch.kmer_spectrum(k=4)        # counts of all 4^4 k-mers in the batch
    spectrum = s if spectrum is None else spectrum + s
# spectrum[i] = how many times k-mer #i appears across the whole file

Both run with zero per-read objects; ambiguous bases (N) are skipped from k-mers.

Fast FASTQ quality report (FastQC-style)

python -m bioforge.qcreport reads.fastq.gz        # or: bioforge-qc reads.fastq.gz

One pass, constant RAM. Reports read/base counts, length, overall GC, mean quality, %reads ≥ Q20/Q30, plus per-read quality and GC histograms, per-position mean quality (the FastQC signature plot) and per-base composition — all built on the columnar API. Use -o report.txt to save it.

Translate DNA to protein

from bioforge import SmartTranslator

protein = SmartTranslator.translate(seq)
print(protein.to_string())   # MVHLTPEEKSA

Detect mutations between two sequences

from bioforge import SequenceAligner, format_alignment

result = SequenceAligner.align(seq_ref, seq_query)

print(f"Identity: {result.identity:.1%}")
print(format_alignment(result))

for mut in result.mutations:
    print(mut)
# Mutation(kind='substitution', pos_a=18, pos_b=18, sym_a='A', sym_b='T')

Map long reads to a genome (Level 4 — seed-chain-align)

Locate reads in a reference far beyond what the O(m·n) aligner can handle, minimap2-style: minimizer seeding → chaining → banded extension of the full read. The entire pipeline runs in C behind an opaque index handle; Python is a thin cover (with a verified, identical NumPy fallback).

from bioforge import GenomeAligner

# Single sequence, or a whole multi-contig genome:
mapper = GenomeAligner({"chr1": chr1_seq, "chr2": chr2_seq, "plasmid": p_seq})

for m in mapper.map(read):
    print(m.to_paf())                # standard PAF, one line per mapping
    print(m.target_name, m.strand, m.target_start, f"{m.identity:.1%}")

# Map many reads in parallel — OpenMP inside the C engine (GIL-free):
results = mapper.map_batch(reads, n_processes=0)   # 0 = all cores

Handles multi-chromosome references (reports the contig + local coordinates), both strands, aligns the full read, tolerates mismatches/indels, and reports a mapping quality. Built once, the C index is reused for every query; map_batch maps the whole batch in a single C call parallelised with OpenMP.

Speed, honestly. The whole pipeline runs in C (SIMD banded extension + OpenMP batch). In a same-machine head-to-head (tools/bench_vs_minimap2.py, 4.8 Mb genome, 6000 simulated reads at 5% error, minimap2 -a), BioForge is on par with minimap2 on multiple cores (~4.3–5.0 vs ~4.3–4.9 Mb/s, sometimes ahead) and ~1.18× behind single-threaded (~1.87 vs ~2.2 Mb/s) — both map all reads. Please reproduce it yourself and tell me where it breaks.

Honest caveats: this is E. coli scale with simulated reads; minimap2 — years of hand-tuning, by a team — may well pull ahead at human-genome scale, on real noisy data, or with many cores. This is not "we beat minimap2"; it's "a from-scratch, pip install-and-go engine got competitive," and the goal from here is a niche it doesn't occupy (see Roadmap).

Reproduce the benchmark yourself (Linux/WSL, with minimap2 installed):

pip install bioforge
git clone https://github.com/erlanders177/bioforge.git && cd bioforge
python3 tools/bench_vs_minimap2.py --genome 4800000 --reads 6000 --error 0.05
# prints Mb/s for minimap2 and BioForge at 1 thread and all cores, same reads.
# Numbers are relative to your machine — report back what you get.

Accuracy — fast is worthless if it's wrong. On a real E. coli K-12 genome (4.64 Mb, 5000 simulated reads, recording each read's true origin, ±50 bp tolerance): BioForge maps ~99.8% of reads to the correct position — matching minimap2 (99.8% at 5% error, 99.7% vs 99.9% at 10%), with 99.8% concordance between the two. So it's not fast-at-the-cost-of-correctness. Reproduce with tools/accuracy_vs_minimap2.py (grab a real genome from NCBI first). Honest note: at higher error minimap2 is marginally ahead, and this is E. coli scale — larger genomes may differ.

Align many sequences at once (Level 4 — multiple sequence alignment)

Line up several sequences column-by-column — the basis for consensus, phylogeny and the evolution front. Uses the center-star heuristic (align all to a central sequence via the C aligner, then merge gaps), ideal for sets of similar sequences (e.g. the same gene across strains over time).

from bioforge import align_multiple

msa = align_multiple([
    "ATGGCCTTAGGCTA",
    "ATGGCGTTAGGCTA",
    "ATGGCCTTAGCTA",     # a deletion
    "ATGGCCTTAGGCTAA",   # an insertion
])
for row in msa.aligned:
    print(row)            # all rows same length, homologous columns
print(msa.consensus())    # majority consensus (N where ambiguous)

Every row with its gaps removed reproduces the original sequence exactly (no data loss). Honest scope: center-star is the simple, correct starting point and shines on similar sequences; serious aligners (Clustal Omega, MAFFT, MUSCLE) use progressive + iterative refinement for divergent sets — a future upgrade.

Evolution: rank the mutations that will rise (Level 5 — v7.0)

Given dated sequences of a gene under selection (e.g. a flu HA across seasons), BioForge ranks which mutations are most likely to rise next, designates stable lineages, and backtests every prediction against the trivial "tomorrow = today" baseline. Genome-agnostic: nothing about flu or any organism is hard-coded. The date goes in the FASTA header (a year, or YYYY-MM).

# Rank candidate mutations (site, target residue) by probability of rising:
bioforge-evolution rank strains.fasta --top 20

# Only mutations never seen before — where counting can't help and this earns its keep:
bioforge-evolution rank strains.fasta --novel --translate

# Is the model actually better than "tomorrow = today"?  (the honest judge)
bioforge-evolution backtest strains.fasta

# Designate stable lineages (Pango/autolin-style) with their defining mutations:
bioforge-evolution lineages strains.fasta
from bioforge import rank_mutations
r = rank_mutations(protein_seqs, years, novel_only=True)
for site, residue, score in r.ranked[:10]:
    print(site + 1, residue, round(score, 3))

How it works, and the honesty that comes with it (this is a research tool, and its own measured limits are baked in):

  • The right question. Predicting exact frequencies is a dead end — it ties the naive baseline at every horizon we tested (3–18 months), because the naive baseline is nearly optimal there. So instead we do what the field actually does (EVEscape, Łuksza): rank mutations (AUC). Here the naive baseline doesn't even play — "nothing changes" ranks nothing.
  • Three genome-agnostic axes feed a small trained model: how a site has changed in the past (a data-driven stand-in for structural accessibility), the physico-chemical (dis)similarity of the substitution, and its recent growth. Notably, the "escape" dissimilarity axis is inverted — in flu HA the substitutions that rise are conservative, replicated across H3N2, H1N1 and B. It measures viability, not escape (without a structural-accessibility term, most of a domain is core: "disruptive" means "breaks the protein", not "escapes").
  • The model is a tiny neural net (MLP 2×64) run in pure NumPy — training used PyTorch as scaffolding, but the shipped model is a 39 KB .npz and inference is three matrix multiplies. No PyTorch, no GPU, runs on a laptop. It beats a plain linear model on all six held-out tests (per-virus and cross-virus — trained on two influenza types, tested on a third), which is where it helps most.
  • What it is not. None of this is scientifically novel — DERIVE, EVEscape and Hie et al. already rank escape mutations and cross viruses, with more resources and usually better. An optional ESM-2 axis (pip install bioforge[ai]) exists but suffers pretraining leakage (its AUC drops ~0.20 on data after its training cutoff — measured, and off by default). The value here is the integrated, honest, laptop-runnable box, not a new state of the art.

Full mutation analysis pipeline (DNA + protein)

from bioforge import run, build_report

result = run("reference.fa", "query.fa", mode="both")
print(build_report(result))

Error handling

from bioforge import BioForgeError, TranslationError, SmartImporter, SmartTranslator

try:
    for rec in SmartImporter.stream_fastq("reads.fastq.gz"):
        protein = SmartTranslator.translate(rec.sequence)
except TranslationError as e:
    print(f"Translation failed: {e}")   # e.g. no ATG found
except BioForgeError as e:
    print(f"BioForge error: {e}")       # ANY engine error: parse, I/O, decompress…

One exception family. Every engine error subclasses BioForgeError, so a single except BioForgeError catches them all — translation, alignment, parsing, file I/O (BioForgeIOError), engine/decompression (EngineError). Each also subclasses the matching builtin (ValueError, OSError, RuntimeError…), so existing except OSError-style code keeps working.

Run the verifier (no coding knowledge required)

python check.py

Project structure

bioforge/               Python package — all core modules
  __init__.py           Public API entry point (from bioforge import ...)
  biocore.py            Level 1 — 5-bit storage engine
  smart_translator.py   Level 2 — DNA → protein translation
  aligner.py            Level 3 — pairwise alignment + mutation detection
  minimizers.py         Level 4 — canonical (w, k) minimizers (C + NumPy)
  refindex.py           Level 4 — reference minimizer index (hash-sorted lookup)
  genomemap.py          Level 4 — GenomeAligner: seed-chain-align → PAF
  msa.py                Multiple sequence alignment (center-star) — evolution's base
  evolution.py          Level 5 — mutation ranking, stable lineages, backtesting
  fetch.py              Level 5 — dated NCBI Entrez download (stdlib, cached + retries)
  evocli.py             Level 5 — bioforge-evolution CLI (rank/backtest/lineages)
  ai/viability.py       Level 5 — optional ESM-2 axis (bioforge[ai], lazy-loaded)
  data/                 Trained mutation-ranker weights (.npz, in the wheel)
  analyze.py            Full pipeline: DNA + protein analysis, report generation
  qcreport.py           Fast FASTQ quality report (FastQC-style, columnar)
  bgzf.py               BGZF converter (parallel block gzip) — bioforge-bgzip
  engine/
    engine.c            C source — pack/unpack, NW, translate, parser, mapper
    engine.dll          Compiled C backend (Windows; .so on Linux/macOS)
    _loader.py          ctypes wrapper with automatic NumPy fallback
    build.py            Compiles the DLL/SO (auto-detects GCC)

check.py                Non-programmer verifier (runs all checks automatically)
conftest.py             Pytest fixtures shared across all tests

tools/
  visor.py              Interactive step-by-step translator (CLI)
  comparador.py         Sequence comparator tool (CLI)
  stress_test.py        30M-base performance benchmark
  bench_vs_biopython.py BioForge vs Biopython: time + RAM (FASTQ parse/QC/load)

tests/
  test_biocore.py       L1: property-based tests (Hypothesis) + benchmarks
  test_translator.py    L2: genetic code correctness + error paths
  test_aligner.py       L3: alignment properties + mutation detection
  test_analyze.py       Pipeline: full integration tests + CLI tests
  test_streaming.py     Streaming/batch parser + columnar API (Sequence/ReadBatch)
  test_qcreport.py      FASTQ quality report (qcreport.py)
  test_minimizers.py    L4: canonical minimizers (C == NumPy parity)
  test_refindex.py      L4: reference index lookup
  test_genomemap.py     L4: seed-chain-align, multi-contig, PAF, robustness
  test_cindex.py        L4: opaque C index parity (bio_index_build)

docs/
  architecture.md       Design rules, levels, encoding details
  api_reference.md      Code examples for every module
  benchmarks.md         Measured numbers and methodology
  roadmap.md            Status and planned extensions

How the vectorisation works

Translation (Level 2)

① decode PackedSequence → uint8 array  [0–3 per nucleotide]
② find first ATG        → C engine scan / NumPy sliding_window_view
③ extract ORF, reshape  → (N, 3) codon matrix
④ base-4 index          → idx = n₁×16 + n₂×4 + n₃  (vectorised)
⑤ CODON_LUT[idx]        → amino acid array  (single fancy-index)
⑥ argmax on STOP mask   → truncate at stop codon

Alignment (Level 3)

Needleman-Wunsch has a cell-level data dependency that prevents full 2D vectorisation. The solution: anti-diagonal wavefront.

Cells on the same anti-diagonal (i + j = d) are mutually independent, so each diagonal is a single vectorised operation.
Python-level iterations: O(m+n) instead of O(m·n).

When the C engine is available, the entire DP matrix is computed in C with OpenMP, giving ~29× speedup over the NumPy wavefront.

C engine

bioforge/engine/engine.c provides optimised implementations of all hot-path operations. Loaded automatically via ctypes at import time.
If engine.dll is missing, all code falls back to NumPy silently.

from bioforge.engine._loader import C_AVAILABLE
print(C_AVAILABLE)   # True if C engine loaded, False if using NumPy fallback

Running the tests

# Full test suite (452 tests)
pytest tests/ -v

# Benchmarks only
pytest tests/ --benchmark-only

# Quick smoke check (no coding knowledge required)
python check.py

Known limitations

Limitation Detail
Aligner memory (full NW) O(m·n) matrix — sequences > 15 000 bp may exhaust RAM. Use band=N for large sequences.
Protein auto-detection Sequences without E/F/I/L/P/Q/* are classified as nucleotides. Use force_type=SeqType.PROTEIN to override.
C engine Ships pre-compiled in the PyPI wheels. Building from source on an unsupported platform needs GCC (python bioforge/engine/build.py).
Banded NW (NumPy fallback) Without the C engine, banded NW uses the full matrix with NEG_INF masking — same result, standard RAM.
Genome mapper — tested scale Benchmarked on par with minimap2 on multi-core and ~1.18× behind single-threaded at E. coli scale with simulated reads (tools/bench_vs_minimap2.py). Not yet validated at human-genome scale or on real noisy data, where minimap2 may pull ahead.

Roadmap

  • Level 1 — 5-bit storage, FASTA parser, SmartImporter
  • Level 2 — vectorised genetic code translation (C + NumPy)
  • Level 3 — Needleman-Wunsch alignment + mutation detection (C + NumPy)
  • Full mutation analysis pipeline (DNA + protein, 3 modes)
  • BioForgeError exception hierarchy for library users
  • Reverse complement vectorised — PackedSequence.reverse_complement()
  • 6-frame translation — SmartTranslator.translate_all_frames()
  • Banded NW — SequenceAligner.align(seq_a, seq_b, band=N)
  • Smith-Waterman local alignment — SequenceAligner.align_local()
  • Streaming FASTA/FASTQ parser in C — SmartImporter.stream() / stream_fastq()
  • Batch parser (5-bit encoding in C) — ~80 M bases/s FASTA, ~94 K reads/s FASTQ
  • Columnar QC API — stream_fastq_batches() · ReadBatch.passes() / filter()
  • Compressed .gz decoded in C (zlib, static-linked, transparent)
  • Object-free columnar k-mer spectrum + per-read GC — kmer_spectrum() / gc_content()
  • Benchmark vs Biopython — tools/bench_vs_biopython.py
  • Fast FASTQ quality report (FastQC-style) — bioforge-qc / bioforge.qcreport
  • Adaptive multi-core dispatcher — n_threads=: parallel parse + libdeflate .gz
  • BGZF parallel-decompressible .gz + converter — bioforge-bgzip
  • Native per-platform wheels on PyPI (cibuildwheel) — pip install bioforge
  • Long-read / genome-scale aligner — GenomeAligner (seed-chain-align, PAF)
  • Whole mapping pipeline in C behind an opaque index — bio_map_read / bio_map_batch (OpenMP)
  • SIMD banded extension (AVX2, int32 + int16) — _nw_banded_diag_simd (v6.0 / v6.2)
  • Columnar map_batch output → full multi-core scaling (v6.1)
  • Head-to-head benchmark vs minimap2 (tools/bench_vs_minimap2.py, WSL) — on par multi-core
  • Multiple sequence alignment (center-star) — align_multiple (v6.3)
  • Evolution front — mutation ranking, stable lineages, honest backtestingbioforge-evolution (v7.0)
  • Trained mutation-ranker (MLP in pure NumPy, no PyTorch at inference) + optional ESM-2 axis (v7.0)
  • Structural-accessibility axis (to separate escape from viability) — the term EVEscape has and we don't
  • Validate the mapper at human-genome scale on real (non-simulated) reads

References & inspiration

BioForge's genome mapper (Level 4) is an independent, from-scratch implementation of well-established, published algorithms. No third-party source code is included or copied — only the ideas from the scientific literature, which is what publishing them is for. With gratitude to:

  • Minimap2 — Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics, 34(18), 3094–3100. The seed-chain-align strategy and the chaining dynamic program that inspired genomemap.py. (paper · MIT-licensed source)
  • Minimizers — Roberts, M., Hayes, W., Hunt, B. R., Mount, S. M., & Yorke, J. A. (2004). Reducing storage requirements for biological sequence comparison. Bioinformatics, 20(18), 3363–3369. The (w, k) minimizer sampling behind minimizers.py.
  • Needleman–Wunsch (1970) and Smith–Waterman (1981) — the classic dynamic-programming alignments behind Level 3.

BioForge is not affiliated with or endorsed by the authors of the above.


Author

Aarón Aranda Torrijosgithub.com/erlanders177


License

PolyForm Noncommercial 1.0.0 — free for personal, academic and research use.
Commercial use requires explicit permission from the author.

See LICENSE for full terms.

About

High-performance bioinformatics engine for edge computing. 5-bit encoding, vectorised alignment, DNA→protein translation, and a minimap2-style genome mapper — whole pipeline in C behind a thin NumPy cover. pip install bioforge.

Topics

Resources

License

Stars

1 star

Watchers

1 watching

Forks

Packages

 
 
 

Contributors